defer defer
  • 07-09-2015
  • Mathematics
contestada

What is 16 more than the quotient 84 and 12

Respuesta :

samrawit samrawit
  • 07-09-2015
84÷12=7
7+16=13
23 is more than the quotient of 84 and 12
Hope this helps!
Answer Link

Otras preguntas

Read this passage from Robert E. Lee’s “Letter to His Son.” What is Lee’s main point about Washington? "I received Everett’s Life of Washington which you sent
In a certain city, the hourly wage of workers on temporary employment contracts is normally distributed. The mean is $15 and the standard deviation is $3. What
Which of the following organisms does not have a cell wall?
You can open a can of soda at room temperature and hear a hiss which of the following factors has change inside the container
Please help !!!!!!!! Find - X when x =71
PLEASE HELP FOR 50 POINTS Henderson is researching the claim that the HIV virus is transmitted through the air. Which of the following sources should Henderson
Madison is making party favors she wants to make enough favors so each guest gets the same number of favors she knows that I’ll be six or eight guests at the pa
Find the value of y. 4 2 √3 6 6 √3
What is the complementary DNA strand for the following sequence: ATGGCTTGCCAAGGTCCGGAAACTTTG
Solve ( x + 1 < 5) ∩ ( x - 4 > -3). {all real numbers} { x | 1 < x < 4} { x | x < 4 or x > 1}