ghunderman24 ghunderman24

09-01-2019
Chemistry

contestada

What is the complementary DNA strand for the following sequence:
ATGGCTTGCCAAGGTCCGGAAACTTTG

Respuesta :

alexandraderigg alexandraderigg

09-01-2019

TACCGAACGGTTCCAGGCCTTTCAAAG

Answer Link

Otras preguntas

What does expansion of states mean

How do state constitutions control the economy? a. set trade with other states c. settle debts with the federal government b. coin monies d. decide how to raise

is the route square of 154 rational or irrational

A recursive function is shown below: f(1) = 4 and f(n) = f(n - 1) - 8; n > 1 Which of the following lists the terms in the sequence defined by this recursive

The upper classes in colonial America consisted of: professional people, artisans, and farmers planters and merchants indentured servants

President Kennedy signed education laws to help students of technology. students with disabilities. students in space programs. students in the Peace Corps.

The result of the battle of bunker hill was a/an A- narrow victory for the Americans B- inconclusive end C- clear victory of the Americans D- in qualified Briti

Write the equation of the line that passes through (1, 3) and has a slope of 2 in point-slope form. A) y – 1 = 2(x – 3) B) y – 3 = 2(x – 1) C) x – 1 = 2(y – 3)

The market where business sell goods and services to households and the government is called the A. goods market B. factor market C. capital market D. money mar

Which of the following describes the BEST method for keeping the endocrine system healthy? A. exercise regularly B. eat a healthy and balance diet C. manage st