kaaaY4ar6enocelyn kaaaY4ar6enocelyn

09-04-2017
Mathematics

contestada

Aisha worked 8 3/4 hours on thursday and 7 2/4 hours on friday. how many hours did she work during these days?

Respuesta :

Аноним Аноним

09-04-2017

8+7+3/4+2/4
= 15 5/4
= 16 1/4

Answer Link

Otras preguntas

Classify the pair of angles. Then find the value of x.

What change happens when matter changes states?

for each one fifth, use a horizontal line or lines to show fractions equivalent to 1/5 and write the equivalent fractions

17 — 5 — 6x — х2 Can u help me with this

How do you write 58.84% as a decimal?

Please help me out with this

TACTTAGAGGCACCACATGGGCCTTGCACT to mRNA

Hi! If you could please do my paper, I'd be grateful! I'll also mark brainiiest for the best. Here's the topic: How did Africans continue to practice their nati

A football team lost a total of 2 1/2 yards in 5 plays. What was the average change in yardage per play?

Describe how the cotton gin transformed slavery?