jls7281 jls7281
  • 08-01-2021
  • Biology
contestada

TACTTAGAGGCACCACATGGGCCTTGCACT to mRNA

Respuesta :

mathsbeginer
mathsbeginer mathsbeginer
  • 12-01-2021

Answer:

I don't know the answer

Explanation:

is is this even a question cos I don't think so.

Answer Link

Otras preguntas

what is a crab nebula
Which of the following best states the difference between a theme and a topic?
what is a4 x 7a = 4a x 5
Luke shaded 20 squares on his hundreds grid Bella shaded 30 squares on her grid what two decimals are greater than Luke's decimal but less than Bekka decimal
how is an ionic bond formed between two atoms? A. both atoms lose electrons. B. both atoms gain electrons. C. one atom shares an electon with another atom.D.one
The contractile units of skeletal muscles are ________.
Match each technology to its use in flu treatment. A. Rapid tests B. DNA-based tests C. Antiviral drugs 1.Reliable diagnosis 2.Quick diagnosis 3.Treatment of
What is a biochemical in the sport Golf?
what are Steps of the Writing Process?
What is 7.8×1057.8×105 hours in days? A) 3.250×1043.250×104 days B)1.872×1041.872×104 ​ days C)3.250×1063.250×106 ​​ days D)1.872×1081.872×108