Seudónimo Seudónimo
  • 07-10-2021
  • Arts
contestada

I need some movie ideas to make. Can be fantasy and adventure.

Respuesta :

boricuaperez
boricuaperez boricuaperez
  • 07-10-2021
Maybe an idea about a video game like world where the main protagonist has a simple small job that doesn't contribute to the plot but a twist could come and the protagonist becomes a villain like character that corrupts the world and breaks a fifth wall.
Answer Link
futurefried4
futurefried4 futurefried4
  • 28-02-2022
A idea is to try to make a story where you try to sneak into area 51.2 and you find.......
Answer Link

Otras preguntas

PLEASE CHECK MY GRAMMAR!!! Please do not use a translator! Thank you!!! Mi destino de vacaciones favorito es Cancún, México. Soy el único miembro de mi familia
Dr. Cranberry suspects that her client is selectively failing to recall an event that must, by all evidence, be stored in his memory. If the therapist turns out
I always get the transition word questions wrong !! Any tips ?
A scientist sequencing mRNA identifies the following strand: CUAUGUGUCGUAACAGCCGAUGACCCG What is the sequence of the amino acid chain this mRNA makes when it is
Cound someone please help me on this, I'm stuck. ​
find exact value of cosine Theta for an angle Theta with a sine theta equals 3/8 and with its terminal side in quadrant 1​
Describe briefly how you would detect the presence of a non-culturable prokaryote in an environmental sample.
If you can solve it.Thanks in advance
How does the addition of salt or sugar help preserve food?
can someone explain how to do this, please?​