1selindik 1selindik

09-04-2020
Mathematics

contestada

in how many ways can the first and second place in a battle of the bands be arranged if 8 bands practice?

Respuesta :

RobertZein RobertZein

09-04-2020

Answer:

= 28

Solution:

C(n,r)=?

C(n,r)=C(8,2)

=8!(2!(8−2)!)

= 28

Answer Link

fieiedissuisis fieiedissuisis

09-04-2020

The correct answer would be 28

Answer Link

Otras preguntas

-8x-6 pls holpp :((((

A local little league has a total of 60 players, of whom 20% are right handed. How many right handed players are there.

Plz hurry! Timed test! The map shows roads, canals, and navigable rivers in 1850. The Erie, Chesapeake and Ohio, and Pennsylvania canals connected O Northeast

The next question refers to the dialogue that follows. The paragraphs have been numbered to help you identify them more easily. (1) Logan sighed as he sat on th

The dietary manipulation that is related most significantly to longevity in animal studies is:__________ A) protein restriction. B) low fat intake. C) calori

Connor downloads songs for $1.00 each. His cost is shown on the graph, along with Lanise's costs. If Connor downloads 12 songs, how much could he save if he swi

Hi I have my answer in I’m just confused and think it’s gonna be wrong so could u guys help me

james is building a 10-inch by 12-inch rectangular picturee frame. To assure the frame has right angles, james measures thew two diagonals to se if they are equ

If a truck weighs 1200 kg and is traveling at 30 m/s, how much kinetic energy does it have?

TACTTAGAGGCACCACATGGGCCTTGCACT to mRNA