taboracinthia
taboracinthia taboracinthia
  • 09-11-2018
  • Mathematics
contestada

Which number is a factor of 12, but not a multiple of 6?

A.10
B.8
C.4
D.9

Respuesta :

Аноним Аноним
  • 09-11-2018

So yes, your answer is 4.

Hope this helps.

Ver imagen Аноним
Answer Link

Otras preguntas

TACTTAGAGGCACCACATGGGCCTTGCACT to mRNA
Which measurements could NOT represent the side lengths of a right triangle? O 8 cm, 15 cm, 17 cm O 20 cm, 21 cm, 29 cm O 36 cm, 77 cm, 85 cm O 7 cm, 28 cm, 32
Los estudiantes ______ las preguntas. contestan contestamos contestáis contesta
Please Help! It’s due today!
Tritium (H-3) is a radioactive isotope of hydrogen with a half-life of 12.3 years. How long would it take for a 40.0g sample to decay down to 1.25g
Why are volcanoes so important to geologists?
find the value of X ​
A bag contains exactly 22 solid-colored buttons: 4 red, 6 blue, and 12 white. What is the probability of randomly selecting 1 button that is not white?
Which of the follwoing supplies us with the energy we need? DAP ATP ATM
No this is not it ugh