laifstripe16 laifstripe16

10-09-2018
Chemistry

contestada

The number of protons in an atom is defined by it's

Respuesta :

10-09-2018

The atomic number defines the number of protons in an atom.

Answer Link

Otras preguntas

what is the mean absolute deviation of the following set of data 10 8 10 6 6 2 10 4

Perform your simulation for 10 U.S. households. Run your simulation three times (in other words, run three trials). Make your procedure clear by marking directl

Johnny put $325 in a bank account for a year. he earned $19.50in simple interest at the end of the year. what was the interest rate for the year.

Which of the following was not a group charged with being anti-American during the Red Scare of 1912 to 1920? a) Socialists b) Communists c) Anarchists d) Envir

Sariling pananaw tungkol sa nobela niyang Noli Me Tangere

If (x + iy)3 = u + iv, then show that u/x + v/y = 4(x2 – y2)

Of the DNA sequences below, which would probably be the harder to determine? a) CGATATATATATATACGATGGCATCACGAGCTGCATTCGCA b) CGATATATATATATACGATGGCATCACGAGCTGCA

Hyia was burned slightly when a spark from a campfire landed on her hand. She is now also afraid of gas grills at cookouts. a) True b) False

Prove that the function given by f(x) =log sinx is strictlye increasing on (0,π/2) and strictly increasing on (π/2,π)

NEED ANSWER ASAP What does the winner-take all voting districts NOT vote for? A. Political parties B. People to represent the citizens Political parties