jasminestewart5142 jasminestewart5142
  • 06-04-2024
  • Biology
contestada

Of the DNA sequences below, which would probably be the harder to determine?
a) CGATATATATATATACGATGGCATCACGAGCTGCATTCGCA
b) CGATATATATATATACGATGGCATCACGAGCTGCATTCGCA

Respuesta :

Otras preguntas

1.When you are stressed, you may be more likely to make _______ choices about food.
How do I find Y in 6=4x+y?
Which word best describes a characteristic of Postmodernism?   A. Linear   B. Academic   C. Traditional   D. Fragmented
How do the properties of an atom compare(similar or different) to the properties of : a. an isotope of that atom b. an ion from that atom?
What is responsible for the gradual decline in sea ice
Explain how a country is affected by AIDS, and the importance for the country's future
write 28+60 as a product of their greatest common factor and another sum
Help asap please asap!!! Andrea couldn't sing very well. She was off-key and too loud. Which word would fit in a description of Andreas singing? A: shriek B:
What do you know about the signs of two intergers whose product (a) positive and (b) negative?
solve this quadratic equation x^2+8x=10 ? WELPPPPP