DabFoYoMa DabFoYoMa

06-06-2017
Mathematics

contestada

HELP ASAP WILL GIVE BRAINILIST
Write a whole number between 1 and 10, and then write its reciprocal.

Respuesta :

mayson25861 mayson25861

06-06-2017

5, and 1/5
2, and 1/2
7, and 1/7

Answer Link

Otras preguntas

¿Cómo se dice “It is very cold.” en español?

In the three-dimensional structure of methane, ch4, the hydrogen atoms attached to a carbon atom are aligned ________. in the three-dimensional structure of met

Marquez is described as an "artist of language". Which trait of excellence in writing does this BEST represent? a. has strong impact on reader b. uses powerfu

Year-old lucy needs to have a blood sample taken. she is so distraught by this that she must mentally prepare herself for it as well as take a short-acting seda

25 pt question amd will mark brainliest

If you were given a 3D microscope to use for photography, which object(s) would you most want to photograph?

what goal did Kennedy want the us to accomplish before the end of the 1960's

Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequences are always written 5' to 3

What was one of the problems faced by the united states after ww2?

Terminacion colectiva de las relaciones de trabajo concepto