SophiaYou SophiaYou
  • 07-04-2017
  • Mathematics
contestada

Need help pls help correct answer only

Need help pls help correct answer only class=

Respuesta :

theandysanchez
theandysanchez theandysanchez
  • 07-04-2017
c .583 repeating use calculator 
Answer Link

Otras preguntas

Why were the french and british seizing our ships?
WILL CROWN BRAINLIEST!!!!!!
How did the issue of state rights influence south carolina's decision to secede from the union
It seems like everyone has a cell phone these days. Sounds, images, and the written word can all instantly be sent using this technology. How do cell phones sen
_____ spotlighted the problems of governing the new nation under the articles of confederation because neither the national government nor an individual state w
To which of the following DNA sequences would the TATA box binding protein bind? A. TAGGCGTATATAGCGCCTTAT B. CCCGTTAATTAATTAACGCGC C. GCGCTTATCTATTACCGTACG D
Who killed mrs huffington
Brooke has been asked to present on the topic below. Persuade students to participate in the annual seventh-grade Fun Run. What would be the most effective
Sylvester and Lin go to the amusement park Sylvester plays 5 rounds of mini golf and takes 4 turns in the batting cage for total of 60 dollars. Lin does 3 round
how will your health most likely be affected if you follow the recommended guidelines for sleep, rest, and physical activity?A. Energy levels will decrease. B.