jesusislord123q jesusislord123q
  • 10-01-2023
  • Mathematics
contestada

Raj was getting a 5% commission, but now he's getting 6.5%. How much more money will he make on $24,000 of sales than on his old commission?

Respuesta :

Otras preguntas

A mouse has made holes in opposite corners of a rectangular kitchen. The width of the kitchen is 2 meters, and the distance between the mouse's holes is 6 meter
How did the launching of the Soviet Union’s Sputnik satellite in 1957 influence American public schools?
My tens digit is 7-2 My ones digit is 2+0 What is the answer
An enzyme is used to unzip they dna 3'ACTGTACCCATGTGTACTGCCC 5' explication​
Which statements describe characteristics that are common to both plants and animals? Check all that apply. They have nuclei. They are autotrophs. They have cel
Which expression is equivalent to y•y•y•z•z•z•z?
the coordinates of triangle DEF is D: (-2,3) E: ( -3,0) F: (1, -2) Triangle DEF is reflected across the x-axis. Which vertex stays the same.
Why might a reader want to be cautious when reading an unauthorized biography?
Countries need the right resources to create products. Which of the following factors is NOT a resource that acountry might need in order to produce something t
The binding energies of K-shell and L-shell electrons in a certain metal are EK and EL, respectively, If a Kαx ray from this metal is incident on a crystal and