cristaltejada8
cristaltejada8 cristaltejada8
  • 06-05-2020
  • Health
contestada

An enzyme is used to unzip they dna 3'ACTGTACCCATGTGTACTGCCC 5' explication​

Respuesta :

iveracisneros98
iveracisneros98 iveracisneros98
  • 06-05-2020

Answer:

With an eye toward understanding DNA replication, Cornell researchers have learned how a helicase enzyme works to actually unzip the two strands of DNA. The results are published in the journal Nature. At the heart of many metabolic processes, including DNA replication, are enzymes called helicases.

Hope it helps?

Explanation:

Answer Link

Otras preguntas

Please Help!! (all three questions!)
The reporter says that no one is talking, so the soldiers start thinking. What are some of the things the reporter says they are thinking about? -Story cbs in V
A CD usually sells for $14.00. If the CD is 20% off, and sales tax is 8%, what is the total price of the CD, including tax?
What are cell membranes What are they made up of How are they structured
help please thank you very much
Helpppppppppppppppppppppp
Sorry it's blurry, the best I could take. But I need to Write a research paper that 2-3 Pages. I just need help. I was thinking if writing it either on art, clo
This organization was created in 1954 to help draw business and industry to South Carolina.
Number 9 please?!?!?!?!
can you help! and an explanation please