skhallskidz skhallskidz

09-05-2022
Biology

contestada

What is the correct numerical sequence for unlocking "DNA Structure?"

Respuesta :

howardclemingtime howardclemingtime

09-05-2022

Answer:

3'TGACGACTACAACTTAATCT

Explanation:

Adenine bonds with thymine; guanine bonds with cytosine. This is the complement DNA sequence.

Answer Link

Otras preguntas

What disease affect the digestive system and the urinary, how?

if all the forces acting on a book are balanced

Simplify the complex fraction-2/7÷1 1/3

How did women in the United States respond to the social changes brought about by World War II? O A. Women put aside their fight for equal suffrage in favor of

From 1990 to 2000 the average temperature in July in Dallas was 97∘ F. A researcher believes due to Global Warming that the average is increasing in Dallas. Whi

Compare the atmospheres of Mars and Venus. Mars is rich in oxygen, like ours, accounting for its red surface. Like Earth, nitrogen is the chief atmospheric gas.

The first prepaid health insurance plans in the United States were

what was the result for Sending troops toSaint Domingue

1) The Code of Conduct is a ____________ for military members when isolated or held against their will by entities hostile to the U.S.

is cell mediated or humoral immunity essential to control a mycobacterium infection ?