alejandrarodriguezpa alejandrarodriguezpa

07-01-2022
Social Studies

contestada

Define the word partisan

Respuesta :

lol318157 lol318157

07-01-2022

Answer:

Partisan (partisanship) an adherent or supporter of a person, group, party, or cause, especially a person who shows a biased, emotional allegiance

Explanation:

Answer Link

Otras preguntas

The rectangular floor of a classroom is 30 feet in length and 36 feet in width. A scale drawing of the floor has a length of 5 inches. What is the area, in squa

Click on the edit DNA, you will now see the original sequence used to make the protein. ATGCCGGGCGGCGAGAGCTTGCTAATTGGCTTATAA

the composite bar chart shows the number of messages jon received each day for five day

a) b) 2 Complete the prime factor trees for 24 and 84: 24 2 |||| 6 2 84 7 2 3 What is the Lowest Common Multiple of 24 and 84? 4 6

PLEASE HELP!!!!!!A set of data includes 98 data points ranging from 0 – 160. If the data is split into classes with a range of 10 (1 – 10, 11 – 20, etc), and th

2. Donald Trump has a mass of 108 kg, calculate his velocity when he has the following kinetic energy: a) 1250 J d) 1.2 kj g) 90 kj

find the measure indicated in each parallelogram

Which ghee is the best?

Read the article about cutlery (knives, forks and spoons) which you can eat. Write a summary about the advantages of edible cutlery compared to plastic cutlery,

The principle of cause and effect is a philosophical concept that seeks to explain the relation between an event (cause) and a second event (effect). Perhaps th