biggerskyhunterme biggerskyhunterme

09-06-2021
Mathematics

contestada

what are point slope equations that pass through points (5,6) and (1,1)

Respuesta :

janise234 janise234

09-06-2021

I think it’s y-6=5/4(x-5)

Answer Link

Otras preguntas

does the law of conservation of energy apply to waves?

In sexually reproducing organisms, such as humans, which of the following statements is TRUE about the DNA found in the cells of the children?

AUUUAACUGUUCUGUCUAGAG 1. Construct an Explanation Based only on the information provided, why could the mRNA section be translated into three different sets of

Your car gets a flat! You go from 90 kilometers per hour to a stop in 6 seconds. What is your rate of deceleration? (it's negative!) I need this asap help

What is the value of x? (-8x = 24) - 6x +18 - 122 Enter your answer in the box X=

Heeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeelllllllllllllllllllppp ( 2 choises)

An art class is making a mural for their school which has a triangle drawn in the middle. The length of the bottom of the triangle is x . Another side is 12 mor

Did British Empire lead to slavery?

Which benefits do mangrove trees provide to surrounding coastal wetlands? 1 . They hold soil in place. 2 . They store floodwaters. 3 . They maintain surface wa

Please help me with these