MateoVogt06 MateoVogt06
  • 09-04-2021
  • Spanish
contestada

Help. I don’t understand

Help I dont understand class=

Respuesta :

kaylingomez2002 kaylingomez2002
  • 09-04-2021

Answer:

i only know that number 6 the first one is "dijiste"

Explanation:

Answer Link
alexac13 alexac13
  • 09-04-2021
4.) dije, digo 5.) dicen, dijeron 6.) dijiste, dices
Answer Link

Otras preguntas

Can someone plzzzz help me it’s easy Spanish for the ones that speak it
¿En cuanto se convertirán L.3000 en 4 años al 8% de interés compuesto anual capitalizable por trimestres?
Each of the following sets of quantum numbers is supposed to specify an orbital Choose the one set of quantum numbers that does NOT contain an error. a) n=4, I
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
A Rectangle has diagonals of length 13 cm and width is 5 cm. Find the length of its side?
Help me and I’ll give you brainliest
The following events took place for Technology Treasures Manufacturing Company during January, the first month of its operations as a producer of digital video
y'all ppl that be deleting ppl's questions/answers including mine could go to hell disrespectfully
what is Mark twain's argument in two ways of seeing a river
HELP DUE IN 10 MINS! What are the values of x and y for the irregular pentagon below. x =?? degrees ° y =?? degrees