ADRIANAP25
ADRIANAP25 ADRIANAP25
  • 09-11-2016
  • Mathematics
contestada

The difference between 21 and the product of three and four

Respuesta :

hoysch
hoysch hoysch
  • 09-11-2016
21-(3*4)=9 Product of 3 and 4 = 12.
Answer Link
Moon1111 Moon1111
  • 09-11-2016
The answer to our question is 9
Answer Link

Otras preguntas

How can playing tennis help you learn how to play pickleball?
What can be done to eliminate the dangers of antibiotic resistance that are all over the world?
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
What is population growth?
Answer and show work. 1.) 9 - t = 3 (t -5) 2.) 5 (5y + 1) =10y - 25
Choose the option that is properly transcribed3. She didn’t even... she really didn’t know how to accept the news.A) She really didn’t know how to accept the ne
Would you expect metals to have high ionization energies or low ionization energies? Support your answer by relating ionization energy to the formatation of ion
What is the value of the "x"? O x = 180 O x = 45 O x = 135 O x = 90
My computer likes to disconnect every 3 or 5 minutes a lot when I turn it on, Is there any solution for this?
Convert the improper fractions to mixed numbers