tyeseanhoward tyeseanhoward
  • 10-02-2021
  • Mathematics
contestada

Write the equation in standard form using integers.
y = - 2/3x -5
The equation in standard form is

Respuesta :

jazming993 jazming993
  • 10-02-2021
The Answer is: 2x+3y=-15
Answer Link

Otras preguntas

how many asteroids do scientists believe exist in the solar system?
What is a musical phrase? i will give brainiest if your right A. a complete thought or sentence in the musicB. a short range of note within a scaleC. a change i
The Jehan Division of a company manufactures and sells Product A. The current selling price is $73 per unit. Per-unit costs are as follows: Direct materials $ 5
Transcribe the following Strand of DNA: GTCCTTTACCATCGATTGGAAAACGTTAAAATCCAGTTCCAT
400+5 please help me
True or False: Anything less than a full bottle shouldn't be considered in inventory at all.
a fibroadenoma is a round, firm, rubbery mass that arises from excess growth of glandular and connective tissue in the breast.
What was the nuclear arms race and how did it contribute to the cold war? Also I need a Paragraph PLEASE HELP
Write the equation in standard form. y + 7 = -3 (x + 1)
what california mountain range was the source of the gold rush?