loversforever2002 loversforever2002

08-02-2021
Mathematics

contestada

find the vertical asymptote y= x-1/x+4

Respuesta :

elrandom elrandom

08-02-2021

Answer:

x = 0

Step-by-step explanation:

Answer Link

Otras preguntas

Word Problem A car covers a distinct of 22.5km in one liter of petrol. How far can it go in 125 liters of petrol?.

Find the area of a circle with radius 2cm, leave your answer in terms of pi

Discuss the issues law enforcement face in understanding cybercrime

Thomas, Saliah, and Leo won the science rocket launching contest. Mrs. Novak allowed each student to randomly choose a prize from a bag. Once the prize is chose

HELP ME if in one if in one lap they give 450 m if they want to cover 18k how many laps should they do

You are given the following DNA sequence and have determined that it is the sense parental strand. ATTGCCATGAAACGCCCCGGTACACCATTGTTCGGCAAATAAAAATAA Wha

The two major political parties in the US are the Democratic party and the __________ party. A. Republican B. Federalist C. Jacksonian D. Constitution

Lucas pushes on a car stuck in a ditch with a force of 1000 N for 15 minutes. The car remains stuck. How much work did Lucas do? Your answer: O 66.7) 0 0 o 1.22

Pre-Test Active TIME REMAINING 42:21 Which statements describe characteristics of a nonrestrictive clause? Select three options. Abel 99 It is set off by commas

The formula s = sqrt((SA)/6) gives the length of the side, sof a cube with a surface area, SA. How much longer is the side of a cube with a surface area of 180