Leahh15 Leahh15

11-01-2021
Mathematics

contestada

Find the GCF of 4 and 20 and please list the factors by the number..

Find the GCF of 4 and 20 and please list the factors by the number class=

Respuesta :

NOTAVIRGIN56 NOTAVIRGIN56

11-01-2021

Answer:

4 20

1-4 1-20

2-2 2-10

4-5

Step-by-step explanation:

Please mark brainliest

Answer Link

Otras preguntas

Pls help :) i will be very happy

This image shows the Great Sphinx. During which era was it constructed?

Find the slope of the line that passes through each pair of points 7. ( 1,2),(4,3) 9. ( 0,2), (4,6) 11. ( 2,4),(6,7) 13. (-3, -2),(4,-2) 15.(5,2),(8,-4) 19. (0

according to the concept of absolutism family

Gabriella swims 2 laps per minute. What is the unit rate?

Why did old beliefs such as alchemy and astrology continue to appeal to elites despite the new ideas and methods of scientists?

When 2/3 of a number is increased by 20, the sum is then halved, the result obtained is the same as 2/3 of the number, increased by 3. Find the number.

Given the following diagram, find the required measure. given: l | | m m <1 = 140° m <3 = 50° https://wca.sooschools.com/media/g_geo_ccss_2016/3/page70a.g

5' ATGCCCGGGTGTCGTAGTTGA3' Complete the complementary sequence for the template strand

Western steer purchased some three-year macrs property three years ago. what is the current book value of this equipment if the original cost was $94,250? the m