salman19 salman19
  • 08-01-2021
  • Mathematics
contestada

12 = q + 7 omg helppp

Respuesta :

mendezkidz5
mendezkidz5 mendezkidz5
  • 08-01-2021

Answer:

q=5

Step-by-step explanation:

Answer Link

Otras preguntas

Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT -5' produces a polypeptide that
Predict problems that may arise from many people tryingto get rich quick​
A 30 ky child running at 7 m/s jumps onto a 10 kg sled which was initially at rest. What will be the velocity of the child+sled immediately after the child jump
Solve for x: 7x - 9 = 33
Assume there is no way to prevent someone from using an interstate highway, regardless of whether or not he or she helps pay for it. This characteristic is call
Verbal aggression is an example of communication competence because it is the tendency to attack issues and positions, not people or their self-concepts. a. Tr
Which distribution had the greatest spread? A Distribution 1 B distribution 2 C distribution 3 D distribution 4
9 times a number increased by 8 is the same as 50 more than 2 times the number. Find the number
The justices of the Supreme Court are ________. Group of answer choices chosen by the Congress nominated by the President and confirmed by the Senate confirmed
Why does the United States trade with Venezuela, even though they have disagreements?