ashleygarcia090817 ashleygarcia090817
  • 06-01-2021
  • Biology
contestada

write the code for RNA from this DNA STRAND :

AAAAAATTTTTTCCCGGGGTTTATATATC

Respuesta :

homadison4
homadison4 homadison4
  • 09-01-2021

Answer:

UUUUUUAAAAAAGGGCCCCAAAUAUAUAG

Explanation:

All you have to do is apply the same concept as DNA, but T (Thymine) is replaced with U (Uracil)

Answer Link

Otras preguntas

an internal conflict features charachter vs A.character B.nature C.self D.society
Simplify (-1-3i) + 2(4+6i). Enter in the form of a+bi
What made the gods want to create earth
The occurrence of a chance event during one trial does not influence the results of later trials. This is an important principle regarding _____.
Why the Sun seems to be red or yellow at different parts of the day?
round 12.083 to the nearest tenth
King Edward I formalized baronial participation in the English government through what institution?
Which statement best describes the main consequence of Mr. Collins asking Elizabeth to dance? Pride and Prejudice By Jane Austen Elizabeth is one of the daughte
On this diagram of a Bocce Ball court, the measure of angle 1 equals the measure of angle 2. What can you conclude?
name the values on the guven digits the 8s on 88,000