djtolitt djtolitt

10-09-2020
Mathematics

contestada

If a = 3b + 4 and b = 7. what is the value of a ?

Respuesta :

imanyasin imanyasin

10-09-2020

Answer:

a=25

Step-by-step explanation:

a=3x7+4

a=21+4

=25

Answer Link

gfelix23 gfelix23

10-09-2020

Answer: A= to 25

Solution: a= 3b + 4 and b= 7 so you plug in the numbers —> 3(7) +4 = a so 3 x 7 = 21 +4 = 25 !

Answer Link

Otras preguntas

Elemental S reacts with O2 to form SO3 according to the reaction 2S+3O2→2SO3 What is the theoretical yield of SO3 produced by 8.79 g of S? Express your answer n

If you mix red with yellow and purple. What color would that turn into?

A scientist sequencing mRNA identifies the following strand: CUAUGUGUCGUAACAGCCGAUGACCCG What is the sequence of the amino acid chain this mRNA makes when it is

Evaluate y^5 for y = 1.

Another characteristic that you want to include in the introduction is bacterial reproduction. Prokaryotic cells have only one chromosome and lack any organelle

Producers use market research in order to do what

A(n) _______ is an uncontrolled positive feedback loop between cytokines and leucocytes.

Where should a scientist look for the most recent and reliable information?

Johnny says he likes his best friend, Andy because he is fun and talks about interesting things. Johnny also says Andy encourages him to do his best and comfort

A person in England arrives at a medical clinic with a fever and swollen lymph nodes shortly after returning from a visit to New Mexico. For which bacteria shou