alyssamendoza66 alyssamendoza66
  • 10-03-2020
  • Mathematics
contestada

If h(x) = x - 7 and g(x) = x2, which expression is equivalent to (gºn(5)?
(5 – 7)2
O (5)²-7
O (5)²(5 – 7)
(5 – 7)x²

Respuesta :

ghanami
ghanami ghanami
  • 10-03-2020

Answer:

Step-by-step explanation:

hello :

(gºh(5) =g(h(5) )

but : h(5) = 5-7=-2

so : (gºh(5) =g(h(5) ) = g(-2 = (-2)² = (5 – 7)2...first  answer

Answer Link

Otras preguntas

5' ATGCCCGGGTGTCGTAGTTGA3' Complete the complementary sequence for the template strand
Which of these activities is typically done in the prewriting phase of writing an essay? writing a rough draft editing surface errors deciding on a topic creati
"how can you visually distinguish between newly formed cells and older cells?
Show me how to solve 384 divided by 55
If 5 chips are chosen without replacement what is the probability that none is white
what is the make up of jazz music
_____ is said to occur when therapists imparting certain basic social skills to their clients maintain eye contact and act assertively. behavioral activation ob
Compare the portraits of god in 1:1-2:4a to those in 2:4b-3:25. what do they say about israel's understanding of god?
There are 150 marbles in 3 bags of marbles. Which of the following expresses the ratio of marbles to bags?
pleas help with the ones you understand