fjfh fjfh
  • 06-11-2018
  • Health
contestada

what are 3 short-term physical effects of tobacco use?

Respuesta :

sonyrich69 sonyrich69
  • 06-11-2018

Alll I know it made by a plant


Answer Link
zenforlife
zenforlife zenforlife
  • 06-11-2018

Loss of work days, lower economic status and even short term hospitalization

Answer Link

Otras preguntas

Find the next two numbers in the pattern 12500, -2500, 500, -100,...
If you have lived during the Vietnam War explain why you would have been a hawk or dove
Which of the following statements are true about genetic engineering? 1: Pieces of DNA from two different organisms are joined. 2: Genes from complex organisms
Dana is intending to breastfeed her baby after he is born. she has read that breast milk differs significantly from cow's milk and that cow's milk should not be
What was the result of the bay of pigs invasion in 1961
What was the defining feature of the Gibson girl look
Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequences are always written 5' to 3
Disability income insurance will provide income to a disabled or ill person ___________.
Which new York museum did the fearless five infiltrate
A recipe requires 4 tsps and 1 fl oz. Which measurement is greater?