julieschumaker3 julieschumaker3

08-03-2024
Mathematics

contestada

What is Max's weekly net pay if he makes $21,510 annually and has 6.2% for Social Security Tax withheld and 1.45% for Medicare Tax withheld?

Respuesta :

Otras preguntas

2s + 36 > 50 do fractional solutions make sense in this context? Why or why not

How can i solve 2.5-1.80x0.25+0.95

Nature has a way of of causing organisms that inherit advantageous traits to survive and reproduce more successfully than ones that don't. This process is known

In one year, Leslie's savings were $250. Dana's savings were 4/5 of Leslie's savings. The next year, Dana increased her savings by 30%. Find the amount of Dana'

EA14. LO 4.7A companyâ€™s individual job sheets show these costs: Overhead is applied at 1.25 times the direct labor cost. Use the data on the cost sheets to p

LO 3.2If a company has fixed costs of $6,000 per month and their product that sells for $200 has a contribution margin ratio of 30%, how many units must they se

The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGGGATAAACTC The left end of this m

which expressions product is modeled by the tilesA. ( x + 1)( x + 3) B. x (x + 3) C. 3 (x + 1 )D. (3x + 1)(x + 1)

Which represents 14/3 as the sum of a whole number and a fraction

Which best explains why lithium should be extracted from recycled lithium-ion batteries? 1. Lithium is found in pure form in nature. 2. Lithium is inexpensive t