mikkidee13681 mikkidee13681

08-02-2024
Biology

contestada

A double stranded DNA molecule with the sequence shown here produces, in vivo, a polypeptide that is five amino acids long.
TACATGATCATTTCACGGAATTTCTAGCATGTA
ATGTACTAGTAAAGTGCCTTAAAGATCGTACAT
Which strand of DNA is transcribed and in which direction?

Respuesta :

Otras preguntas

Which of the following is the largest and most inclusive of Linnaeus's taxonomic categories? A.Phylum B.Kingdom C.Family.

on which planet would a spaceship need the largest force to take off

What two factors does potential energy depend on?

what did Gregor Mendel do to study different characteristics in his genetics experiments? like what type of organism and what type of cross?

If a patient is unemployed, it may be helpful to provide ________ along with addiction treatment.

Could I please have some facts on Fauvism.

Kelly sits on a rock. Her weight is an action force. What is the reaction force?

Completing the square x^2-5x-14

I have to use elimination -6x-6y=6 12x+12y=-12

Colleen Truman earns a 4.5% commission on all sales. In June, her sales totaled $40,000. How much did she earn in commission?