xphamjenny357 xphamjenny357
  • 10-01-2024
  • Social Studies
contestada

the indian concepts of rule of law, parliamentary system and law making procedure was borrowed from the constitution of
(a) usa
(b) uk
(c) canada
(d) france

Respuesta :

Otras preguntas

Who killed Abraham lincoln
Which of the following is a good strategy for involving the audience? A. Have a discussion with them and/or get them into groups. B. Embed a video into your pre
Which figure shows the correct dimensions of a 1/3 scale drawing of the given figure
PB4. LO 3.2West Island distributes a single product. The company’s sales and expenses for the month of June are shown. Using the information presented, answe
Birds bakery has been open 3 times longer than Bridget's bakery and Bridget's bakery has been open for 6 years so how long has Birds bakery been open?
Use the quadratic formula to solve each equation. 1. x^2 − 2x = 12 → a = 1, ???? = −2, c = −12 [Watch the negatives.] 2.1 / 2????^2 − 6???? = 2 → a = 1 / 2, ??
WILL MARK BRAINLIEST!!! Which of the following represents a function?
In healthy individuals, ------------- occurs after 3-4 days of eating less than 50 grams of carbohydrate.
IsChoice D Correct? 9 Which of the following statements about the cytoskeletonis true: A The cytoskeleton is entirely made up of microtubules. B Motor proteins
The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGGGATAAACTC The left end of this m