janelysilva273 janelysilva273

08-12-2022
Mathematics

contestada

Determine if the sequence below is arithmetic or geometric and determine the common difference/ratio in simplest form.

22,16,10

Respuesta :

Otras preguntas

A government spends money in order to: O A. make sure government programs can function properly. B. influence which products will be available to U.S. consumers

find the range y=4-x domain =-2,3,5

Which force determines if an object is going to move or stay at rest? a. Friction Force b. Normal Force c. Applied Force d. Net Force

Why would the South be so interested in the land to the west of the borders of the U.S., in what was then part of Mexico?

Mason randomly chooses a card from a standard deck of playing cards. What is the probability that it is not an ace, given it is a red card

the tRNA for GUCAUCGAUCGAUCGGAUGCC

6. Which of the following represent kinetic energy? * (1 Point) the water behind a dam O a boulder hug from a net over a pit a calculator falling to the floor t

A play is being presented on a circular stage. The two main characters are at positions A and B at the back of the stage. What angle of view between the main ch

I’m so horrible at math, please help

Read the following sentence. If the entire class wanted to take the same subway train, they would have to jam into a crowded compartment. Use context clues to f