kennettzone5907 kennettzone5907

10-11-2022
Biology

contestada

elow is the coding strand of a small gene that codes for a peptide. assume the gene has a traditional start codon. how many amino acids long is the peptide if we assume traditional start and traditional stop codon? 5' aatccgtatctatgaccgtttggaaacactaagcggtactc 3'

Respuesta :

Otras preguntas

Please help me with the question below

I need help with B please

What are some non-examples of Prokaryotes?

How did the development of India's material culture affected by developments elsewhere? Essay format please help

Which of the following gave British customs officers the right to search colonial homes for smuggled goods?

could someone please help me Some people believe that the hula hoop was first invented in the 1950s, but this is not the case. The hula hoop has actually been a

________ believe that higher education should be strongly funded by the government, which would make it inexpensive, or perhaps even free. a. theocrats b. liber

I need the answer asap....

ans is 1 . but I want the method

Yuri and Pete go hiking. Yuri brings \dfrac7{10} \text{ liter} 10 7 literstart fraction, 7, divided by, 10, end fraction, start text, space, l, i, t, e, r, en